Dear Editor
Viral mechanisms of infection of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the agent responsible of the coronavirus disease, 2019 (COVID-19), suggest the involvement of surface receptor for S1 of the angiotensin-converting enzyme 2 (ACE2) and transmembrane protease serine-2 (TMPRSS2) receptors.
1
Single studies have found that single nucleotide polymorphisms (SNP), e.g., ACE2 rs2285666, ACE2 rs2074192, or TMPRSS2 rs12329760, seem to be potentially associated with severity of COVID-19; however, current evidence is still not conclusive.2
Another potential SNP that could be implicated in various clinical diseases (e.g., renal damage, pneumonia, ischemic stroke) and also immunological reaction (i.e., cytokine storm) induced by SARS-CoV-2 is ACE1 rs1799752.3
In fact, evidence suggests that the D allele of this SNP is associated with higher severity of SARS-CoV-2.4
Although ACE2, TMPRSS2 and ACE1 receptors are highly expressed in the lungs and respiratory tract, these receptors are also present in several other tissues explaining the heterogeneity clinical presentation of COVID-19. Accordingly, it could be proposed that these receptors are potentially also associated with the presence of symptoms after the acute phase of the infection, i.e., long-COVID. Mariani et al. have recently observed that post-COVID symptoms are present for up to one year in a heterogeneous population.
5
Additionally, a recent meta-analysis reported that post-COVID fatigue can be present in up to 51% of COVID-19 survivors.6
Our group has recently identified that ACE2 rs2285666, ACE2 rs2074192, TMPRSS2 rs12329760 and TMPRSS2 rs2070788 polymorphisms do not predispose for long-COVID symptoms in previously hospitalized COVID-19 survivors.7
- Fernández-de-las-Peñas C.
- Arendt-Nielsen L.
- Díaz-Gil G.
- Gómez-Esquer F.
- Gil-Crujera A.
- Gómez-Sánchez S.M.
- Ambite-Quesada S.
- Palomar-Gallego M.A.
- Pellicer-Valero O.J.
- Giordano R
Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.
Genes. 2022; 13: 1935
We present here a secondary analysis, genetic part of THE LONG COVID EXPERIENCE STUDY,
7
of the potential association between ACE1 rs1799752 polymorphism and the presence of long-COVID symptomatology.- Fernández-de-las-Peñas C.
- Arendt-Nielsen L.
- Díaz-Gil G.
- Gómez-Esquer F.
- Gil-Crujera A.
- Gómez-Sánchez S.M.
- Ambite-Quesada S.
- Palomar-Gallego M.A.
- Pellicer-Valero O.J.
- Giordano R
Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.
Genes. 2022; 13: 1935
Briefly, unstimulated whole saliva samples were collected from 288 COVID-19 survivors who were hospitalized at three urban hospitals in Madrid (Spain) during the first wave of the pandemic (March-May 2020). All participants provided written informed consent. The study was approved by the Institutional Ethics Committees of all involved institutions (HSO25112020; URJC0907202015920; HUFA20/126; HUIL/092-20). Genotyping collection and procedures have been previously published.
7
Identification of each possible genotype of ACE1 rs1799752 polymorphism was conducted by using specific fluorescent dyes. The ACE1 rs1799752 is an insertion/deletion of an Alu repeat sequence that is interrogated using a pair of assays. The possible variants of the ACE1 rs1799752 (the mutant Alu insertion allele -I allele- and the wild type of deletion allele -D allele-) SNP lead to the following genotypes (D/D, D/I, I/I) derived from the sequence:- Fernández-de-las-Peñas C.
- Arendt-Nielsen L.
- Díaz-Gil G.
- Gómez-Esquer F.
- Gil-Crujera A.
- Gómez-Sánchez S.M.
- Ambite-Quesada S.
- Palomar-Gallego M.A.
- Pellicer-Valero O.J.
- Giordano R
Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.
Genes. 2022; 13: 1935
CCCATTTCTCTAGACCTGCTGCCT [-/ALU] ATACAGTCACTTTTATGTGGTTTC
Demographic, medical comorbidities, and hospitalization data were collected from hospital medical records. Post-COVID symptomatology was collected during a face-to-face appointment conducted by experienced healthcare professionals at 17.8 (SD 5.2) months after hospitalization.
7
Dyspnea at exertion (n = 196, 68%) and fatigue (n = 181, 63%) were the most prevalent post-COVID symptoms in the total sample. Other post-COVID symptoms included pain (n = 117, 40.6%), memory loss (n = 92, 32%) or hair loss (n = 77, 26.7%). The genotype distribution (D/D genotype n = 109, 37%; D/I genotype n = 173, 60%; I/I genotype n = 6, 3%) deviated from that expected based on the Hardy-Weinberg equilibrium, a result also extensively found in published COVID-19 studies. Overall, no significant differences in long-COVID symptoms were observed depending on the genotypes of ACE1 rs1799752 SNP (Table). No sex differences in the genotype distribution (P = 0.723) were either found.- Fernández-de-las-Peñas C.
- Arendt-Nielsen L.
- Díaz-Gil G.
- Gómez-Esquer F.
- Gil-Crujera A.
- Gómez-Sánchez S.M.
- Ambite-Quesada S.
- Palomar-Gallego M.A.
- Pellicer-Valero O.J.
- Giordano R
Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.
Genes. 2022; 13: 1935
TablePre-Infection data and post-COVID symptoms according to the ACE1 rs1799752 Polymorphism Genotype (n = 288).
| D/D (n = 109) | D/I (n = 173) | I/I (n = 6) | P value | |
|---|---|---|---|---|
| Age, mean (SD), years | 58.0 (12.0) | 55.5 (13.5) | 55.0 (12.0) | 0.372 |
| Gender, female n (%)* | 58 (53.2%) | 84 (48.5%) | 2 (33.3%) | 0.723 |
| Weight, mean (SD), kg. | 80.5 (17.0) | 81.2 (17.0) | 80.5 (4.0) | 0.934 |
| Height, mean (SD), cm.* | 167 (8.5) | 167 (10.0) | 170 (6.5) | 0.226 |
| Number co-morbidities, mean (SD) | 1.3 (1.0) | 1.3 (1.0) | 1.3 (1.0) | 0.932 |
| Medical co-morbidities, n (%) | ||||
| Hypertension | 37 (34.0%) | 59 (34.1%) | 4 (66.6%) | 0.406 |
| Diabetes | 15 (13.8%) | 14 (8.1%) | 1 (16.7%) | 0.318 |
| Cardiovascular Diseases | 10 (9.2%) | 11 (6.4%) | 0 (0.0%) | 0.556 |
| Asthma | 11 (10.1%) | 21 (12.1%) | 0 (0.0%) | 0.6237 |
| Obesity | 30 (27.5%) | 59 (34.1%) | 1 (16.7%) | 0.511 |
| Chronic Obstructive Pulmonary Disease | 2 (1.8%) | 4 (2.3%) | 0 (0%) | 0.901 |
| Number post-COVID symptoms, mean (SD) | 3.0 (2.0) | 2.9 (1.8) | 3.5 (2.8) | 0.366 |
| Post-COVID symptoms, n (%) | ||||
| Fatigue | 66 (60.5%) | 110 (63.6%) | 5 (83.3%) | 0.776 |
| dyspnea at exertion | 71 (65.1%) | 121 (70.0%) | 4 (66.7%) | 0.892 |
| Memory Loss | 41 (37.6%) | 47 (27.2%) | 4 (66.7%) | 0.100 |
| Hair Loss | 28 (25.7%) | 47 (27.2%) | 2 (33.3%) | 0.925 |
| Concentration Loss | 17 (15.6%) | 25 (14.5%) | 2 (33.3%) | 0.505 |
| cognitive blunting - brain fog | 18 (16.5%) | 23 (13.3%) | 0 (0.0%) | 0.507 |
| dyspnea at rest | 12 (11.0%) | 25 (14.5%) | 3 (50.0%) | 0.051 |
| Ocular Disorders | 14 (12.9%) | 26 (15.0%) | 1 (16.7%) | 0.882 |
| Anosmia/Hyposmia | 8 (7.5%) | 21 (12.1%) | 0 (0.0%) | 0.342 |
| Skin Rashes | 12 (11.0%) | 24 (13.9%) | 1 (16.7%) | 0.782 |
| Gastrointestinal Disorders | 11 (10.1%) | 16 (9.25%) | 0 (0.0%) | 0.731 |
| Ageusia/Hypogeusia | 9 (8.25%) | 9 (5.2%) | 2 (33.3%) | 0.797 |
| Days at hospital, mean (SD) | 7.3 (7.4) | 8.7 (9.8) | 8.5 (7.7) | 0.415 |
The results of this secondary analysis reveal that ACE1 rs1799752 polymorphism does not predispose to developing long-COVID symptoms when evaluated in previously hospitalized COVID-19 survivors. Current results would agree with our previous report on ACE2 and TMPRSS2 polymorphisms.
7
The lack of association between these SNPs and long-COVID could be explained by the significant gene variability existing (i.e., ethnic differences) across populations.- Fernández-de-las-Peñas C.
- Arendt-Nielsen L.
- Díaz-Gil G.
- Gómez-Esquer F.
- Gil-Crujera A.
- Gómez-Sánchez S.M.
- Ambite-Quesada S.
- Palomar-Gallego M.A.
- Pellicer-Valero O.J.
- Giordano R
Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.
Genes. 2022; 13: 1935
8
Further, the lack of relationship among SNPs associated with COVID-19 severity and the presence of long-COVID reinforce the idea that the severity of the disease is not associated with the development of post-COVID symptoms since the presence of these symptoms is similar between hospitalized and non-hospitalized patients.9
Similarly, the D allele of the ACE1 rs1799752 polymorphism has been associated with a higher risk of hospitalization in patients with co-morbidities at the acute phase of the infection since these individuals are at a higher risk for developing acute respiratory distress syndrome (ARDS).- Fernández-de-las-Peñas C.
- Rodríguez-Jiménez J.
- Cancela-Cilleruelo I.
- Guerrero-Peral A.
- Martín-Guerrero J.D.
- García-Azorín D.
- Cornejo-Mazzuchelli A.
- Hernández-Barrera V.
- Pellicer-Valero O.J.
Post-COVID-19 symptoms 2 years after SARS-CoV-2 infection among hospitalized vs non-hospitalized patients.
JAMA Netw Open. 2022; 5e2242106
10
In our study, no differences in previous medical co-morbidities depending on the ACE1 rs1799752 genotype were observed.- Sabater Molina M.
- Nicolás Rocamora E.
- Bendicho A.I.
- Vázquez E.G.
- Zorio E.
- Rodriguez F.D.
- Gil Ortuño C.
- Rodríguez A.I.
- Sánchez-López A.J.
- Jara Rubio R.
- Moreno-Docón A.
- Marcos P.J.
- García Pavía P.
- Villa R.B.
- Gimeno Blanes J.R
Polymorphisms in ACE, ACE2, AGTR1 genes and severity of COVID-19 disease.
PLoS One. 2022; 17e0263140
Some limitations of the current data should be recognized. First, only previously hospitalized COVID-19 survivors were included, therefore, the role of these SNPs in non-hospitalized patients is yet to be invetigated. Second, it could be possible that larger samples could identify genotype differences, accordingly, our data should be considered exploratory. Population-based cohort studies and a whole genome SNPs analysis might help to validate current results and identify other genes potentially related to long-COVID symptoms.
Role of the funding source
The project was supported by a grant from Novo Nordisk Foundation NNF21OC0067235 (Denmark) and by a grant associated to the Fondo Europeo De Desarrollo Regional - Recursos REACT-UE del Programa Operativo de Madrid 2014–2020, en la línea de actuación de proyectos de I+D+i en materia de respuesta a COVID 19 (LONG-COVID-EXP-CM). Both sponsors had no role in the design, collection, management, analysis, or interpretation of the data, draft, review, or approval of the manuscript or its content. The authors were responsible for the decision to submit the manuscript for publication, and the sponsor did not participate in this decision.
Declaration of interests
No conflict of interest is declared by any of the authors
Acknowledgements
The Center for Neuroplasticity and Pain (CNAP) is supported by the Danish National Research Foundation (DNRF121) and Norvo Nordic Foundation (NNF21OC0067235). We also thank Genomics Unit, Madrid Science Park Foundation, Spain for his valuable support
References
- ACE2 and TMPRSS2 polymorphisms in various diseases with special reference to its impact on COVID-19 disease.Microb Pathog. 2021; 150104621
- Systematic review and meta-analysis of human genetic variants contributing to COVID-19 susceptibility and severity.Gene. 2022; 844146790
- Role of genetic variants and host polymorphisms on COVID-19: from viral entrance mechanisms to immunological reactions.J Med Virol. 2022; 94: 1846-1865
- Association of ACE1 I/D rs1799752 and ACE2 rs2285666 polymorphisms with the infection and severity of COVID-19: a meta-analysis.Mol Genet Genomic Med. 2022; 10: e2063
- Persistence of Long-COVID symptoms in a heterogenous prospective cohort.J Infect. 2022; 84: 722-746
- Post-COVID-19 fatigue among COVID-19 in patients discharged from hospital: a meta-analysis.J Infect. 2022; 84: 722-746
- Genetic association between ACE2 (rs2285666 and rs2074192) and TMPRSS2 (rs12329760 and rs2070788) polymorphisms with post-COVID symptoms in previously hospitalized COVID-19 survivors.Genes. 2022; 13: 1935
- Host genetic variants potentially associated with SARS-CoV-2: a multi-population analysis.Front Genet. 2020; 11578523
- Post-COVID-19 symptoms 2 years after SARS-CoV-2 infection among hospitalized vs non-hospitalized patients.JAMA Netw Open. 2022; 5e2242106
- Polymorphisms in ACE, ACE2, AGTR1 genes and severity of COVID-19 disease.PLoS One. 2022; 17e0263140
Article info
Publication history
Published online: December 27, 2022
Accepted:
December 24,
2022
Identification
Copyright
© 2022 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
